Biology HL · Chapter 1: Elements, Molecules and Water

1.7 Nucleic Acids

Explain how nucleotide chemistry, antiparallel base pairing, replication and chromatin packaging allow DNA to store and transmit genetic information.

Estimated time: 102 minutes

IB syllabus: A1.2 · SL and HL

Nucleotides Build Nucleic-Acid Polymers

DNA and RNA are nucleic acids: long polymers whose monomers are nucleotides. Each nucleotide contains a pentose sugar, a phosphate group and a nitrogenous base. A nucleotide should not be confused with a base. Adenine is a base; an adenine nucleotide also includes sugar and phosphate. The phosphate gives negative charge and hydrophilicity, the sugar participates in the backbone, and the base carries sequence information.

DNA contains deoxyribose, whereas RNA contains ribose. DNA uses adenine, guanine, cytosine and thymine; RNA replaces thymine with uracil. These differences help distinguish the two nucleic acids while both retain a sugar–phosphate backbone and a base sequence.

HL extensionA1.2

At carbon 2′, deoxyribose has H where ribose has a hydroxyl group. The bases also fall into two structural families: adenine and guanine are purines with two fused rings, while cytosine, thymine and uracil are pyrimidines with one ring.

Nucleotides join by condensation to create phosphodiester bonds. The phosphate linked to the 5′ carbon of one sugar connects to the hydroxyl on the 3′ carbon of the next. Repetition creates a sugar–phosphate backbone with chemical direction: one end has a free 5′ group and the other a free 3′ group. Enzymes that copy or express nucleic acids recognize this direction, so 5′ and 3′ labels are functional information rather than decorative notation.

The backbone repeats predictably, but the base sequence can vary. With four possible bases at each position, a sequence of n nucleotides has 4ⁿ possible arrangements. This enormous combinatorial capacity allows DNA to store diverse genetic instructions using the same chemical system in every known organism. The genetic code is described as nearly universal because most organisms interpret the same codons as the same amino acids, with limited exceptions such as some mitochondrial codes.

possible base sequences=4n\text{possible base sequences}=4^n

This counts ordered sequences of length n, not double-stranded molecules after complementary pairing.

Antiparallel DNA and Complementary Base Pairing

A DNA molecule normally contains two polynucleotide strands twisted into a double helix. The strands are antiparallel: one backbone runs 5′→3′ while the other runs 3′→5′. Sugar–phosphate backbones face the aqueous exterior, and bases project inward. Covalent phosphodiester bonds stabilize each strand; hydrogen bonds between complementary bases connect the strands.

Adenine pairs with thymine through two hydrogen bonds, while guanine pairs with cytosine through three. The complementary sequence of either strand can therefore be predicted from the other, which allows genetic information to be copied and transcribed.

HL extensionA1.2

Each base pair matches one two-ring purine with one one-ring pyrimidine, keeping the helix diameter nearly constant. A purine–purine pair would be too wide and a pyrimidine–pyrimidine pair too narrow, so DNA stability depends on both chemical complementarity and geometry.

Hydrogen bonds are individually weaker than covalent bonds, allowing the strands to separate during replication and transcription. Collectively, however, many base pairs stabilize a long molecule while the covalent sugar–phosphate backbone preserves each strand.

HL extensionA1.2

Base stacking also contributes substantially through interactions among adjacent bases. Regions rich in G–C pairs generally require more thermal energy to separate than comparable A–T-rich regions, although sequence context and solution conditions also matter.

Chargaff measured DNA base composition across species and found that the amount of adenine was approximately equal to thymine and guanine approximately equal to cytosine. The total purines therefore approximately equaled total pyrimidines. The ratios differed among species, showing that DNA was not a monotonous repeating molecule. These observations became intelligible when complementary pairing was incorporated into the double-helix model.

X-ray diffraction supplied a different kind of constraint. Rosalind Franklin's carefully prepared DNA fibres and diffraction images showed a repeating helical structure and allowed dimensions to be calculated. The pattern also supported placement of the hydrophilic phosphate backbone on the outside. A successful model had to agree with these measurements as well as with bond geometry and base composition.

Watson and Crick used physical model building to test whether proposed components could fit together without impossible bond angles or atomic clashes. Complementary purine–pyrimidine pairs satisfied both Chargaff's ratios and the constant helix width. The history illustrates how scientific explanations can emerge by integrating chemical data, mathematical inference, images and creative model construction across research groups.

Credit and access to evidence are part of scientific practice. Franklin's data were indispensable, yet she died before the 1962 Nobel Prize awarded to Watson, Crick and Wilkins, and Nobel prizes are not awarded posthumously. Modern accounts distinguish the structure proposal from the experimental contributions that made it possible and use the case to examine collaboration, communication and recognition.

DNA and RNA Comparison Laboratory

Compare DNA and RNA and inspect how complementary, antiparallel strands form a double helix.

Atom → bond → shape → biological role

Biomolecular structure laboratory

DNA · INFORMATION IN BASE SEQUENCEATGCTACGCGATGCTAAT5′3′3′5′
HL extensionA1.2

HL DNA Packaging Laboratory

Increase DNA packing and connect directional strand chemistry to nucleosome organization.

Atom → bond → shape → biological role

Biomolecular structure laboratory

DNA · INFORMATION IN BASE SEQUENCEATGCTACGCGATGCTAATCGGCTACG5′3′3′5′

DNA and RNA Are Related but Not Interchangeable

DNA is usually double-stranded, contains deoxyribose and thymine, and functions as the long-term genetic archive. The absence of a 2′ hydroxyl makes its backbone less prone to hydrolysis than RNA. Complementary double strands provide a template for repair and accurate copying. In eukaryotes, most DNA is in the nucleus, with smaller genomes in mitochondria and chloroplasts; prokaryotic DNA occupies the cytoplasm in a nucleoid region.

RNA is usually single-stranded, contains ribose and uracil, and can fold back on itself through local base pairing. Messenger RNA carries coding information from DNA; transfer RNA brings amino acids to ribosomes; ribosomal RNA forms structural and catalytic parts of ribosomes. Other RNAs regulate gene expression and catalyse reactions. 'Single-stranded' does not mean shapeless: internal pairing can create stems, loops and precise three-dimensional structures.

HL extensionA1.2

The 5′→3′ direction organizes gene expression. RNA polymerase reads a DNA template strand 3′→5′ while synthesizing RNA 5′→3′. Ribosomes then move along messenger RNA in the 5′→3′ direction and interpret successive triplet codons. Directionality ensures that a given sequence is read in a consistent order. Reversing the sequence is not equivalent because the order of codons, and therefore amino acids, changes.

Semi-Conservative DNA Replication

Before cell division, DNA must be copied so each daughter cell can receive a genome. Helicase separates the two strands by disrupting hydrogen bonds and opening a replication fork. Each parental strand acts as a template. Free nucleotides pair by complementarity, and DNA polymerase catalyses phosphodiester-bond formation to extend the new strand.

DNA polymerase adds nucleotides only to a free 3′ end, so every new strand grows 5′→3′. Because the templates are antiparallel, synthesis is continuous toward the fork on the leading strand but discontinuous away from the fork on the lagging strand. Short Okazaki fragments are later joined by DNA ligase. Both new molecules contain one parental strand and one newly synthesized strand, hence semi-conservative replication.

Complementary pairing provides accuracy, but polymerase proofreading and repair systems further reduce errors. A copying error that escapes correction becomes a mutation after another replication cycle. Most of the time replication preserves information; occasional mutations generate new sequence variation. Heredity and evolution therefore depend on a balance between very high fidelity and a non-zero error rate.

The two strands of a DNA region are complementary but not identical. If one is 5′-AGTCC-3′, the aligned partner is 3′-TCAGG-5′. Writing both sequences in the conventional 5′→3′ direction requires reversing the partner to 5′-GGACT-3′. Many examination errors come from applying base-pair rules without also respecting antiparallel orientation.

HL extensionA1.2 AHL

Packaging a Long Genome

A eukaryotic DNA molecule is far longer than the nucleus that contains it. Packaging begins when DNA wraps around a core of eight histone proteins, forming a nucleosome. Negatively charged DNA is attracted to positively charged amino-acid side chains in histones. Linker DNA connects nucleosomes, producing a bead-like organization that can fold and loop into higher-order chromatin.

Packaging solves more than a space problem. It protects DNA, organizes chromosomes and controls access to genes. Tightly packed regions are generally less accessible to transcription machinery, while chromatin remodeling and chemical modification of histones can expose or conceal sequences. During cell division, chromatin condenses further into visible chromosomes, helping prevent tangling and supporting accurate separation.

Prokaryotes do not package their principal chromosome into nucleosomes in the same way as eukaryotes, although they use DNA-binding proteins and supercoiling to compact it. Their main DNA molecule is typically circular and lies in the nucleoid; additional small circular plasmids may be present. Mitochondria and chloroplasts also contain relatively small circular genomes, consistent with their evolutionary origin from prokaryotic ancestors.

A nucleosome core contains a histone octamer, and DNA wraps around it roughly 1.7 turns. A separate linker histone can help secure entry and exit DNA and promote further compaction. Distinguishing the core octamer from an associated linker histone avoids the misleading statement that every nucleosome core is made of nine equivalent histone subunits.

How DNA Was Identified as Genetic Material

In the Hershey–Chase experiment, bacteriophages were used because a phage injects genetic instructions into a bacterium while much of its protein coat remains outside. Researchers labeled phage DNA with radioactive phosphorus-32, taking advantage of phosphate in DNA, and labeled protein with sulfur-35, taking advantage of sulfur-containing amino acids and the absence of sulfur from DNA.

After labeled phages infected bacteria, agitation separated external coats from cells and centrifugation separated the bacterial pellet from the surrounding liquid. Most phosphorus-32 entered the bacterial fraction and later appeared in progeny phages, whereas most sulfur-35 remained with the external coats. The result supported DNA, rather than protein, as the material delivering hereditary instructions in this system.

The conclusion depended on experimental logic, not radioactivity alone. The isotopes selectively distinguished molecular categories, the phage life cycle separated entry from attachment, and fractionation located each label. As with all evidence, the result had a defined scope: it strongly identified phage DNA as genetic material and joined other transformation and biochemical studies in establishing DNA's general hereditary role.

From Stable Archive to Biological Diversity

The same molecular architecture solves two opposing requirements. The covalent backbone and repairable double-stranded structure preserve information, while breakable hydrogen bonds allow access and copying. Complementarity lets each strand specify another, and a four-base alphabet permits an immense number of sequences. DNA is not genetically informative because it differs chemically among species; it is informative because the order of common nucleotides differs.

A gene is a DNA sequence that contributes to a functional RNA or polypeptide product, including necessary regulatory information. Not every DNA region codes for protein. Differences in genes, regulatory sequences and chromosome organization contribute to biological diversity, while the near universality of nucleotide chemistry and the genetic code supports common ancestry. Molecular similarity and variation are therefore read from the same sequence data.

This completes the chapter's chain of explanation. A limited element set supports versatile carbon frameworks; functional groups control reactions with water; condensation builds carbohydrates, proteins, lipids and nucleic acids; molecular geometry produces storage, structural, catalytic, membrane and informational functions. Later chapters will use these molecules in metabolism, cell structure, inheritance and physiology, but their behavior continues to follow the bonding principles established here.

Test Yourself

Double-stranded DNA contains 2,400 nucleotides in total, and 28% of all nucleotides are adenine. How many G–C base pairs are present?

Hint: A = T. The remaining percentage is shared equally by G and C, and each G–C pair contains one G and one C.